🐙
CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
- University Of Illinois Urbana-Champaign
- Champaign
- 19:15
(UTC -05:00)
Pinned Loading
-
- FeatureFlow
FeatureFlow PublicGenome Feature annotations. Annotate a genome assembly with TEs (EarlGrey) and protein-coding genes (BRAKER3)
Nextflow
- pg4Findr
pg4Findr PublicSearch for G-quadruplex motifs in sequencing reads and genome assemblies.
Rust
- fasta2embeddings
fasta2embeddings PublicCreate embeddings out of any fasta/fastq nucleotide sequences. Great for downstream machine learning tasks.
Python
-
Something went wrong, please refresh the page to try again.
If the problem persists, check the GitHub status page or contact support.
If the problem persists, check the GitHub status page or contact support.


